Labirint.ru - ваш проводник по лабиринту книг
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -ГлавнаяОб АльманахеРецензентыАрхив телеконференций- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -Сборники АльманахаДругие сборникиНаучные труды- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -Образец оформленияИнформационное письмоО проведении телеконференции- - - - - - - - - - - - - - - - - - - - - - - - - - - -Материалы I телеконференцииМатериалы II телеконференцииМатериалы III телеконференцииМатериалы IV телеконференцииМатериалы V телеконференцииМатериалы VI телеконференцииМатериалы VII телеконференцииМатериалы VIII телеконференцииМатериалы IX телеконференцииМатериалы Х телеконференцииМатериалы XI телеконференцииМатериалы XII телеконференцииМатериалы XIII телеконференцииУчастники XIII телеконференцииМатериалы XIV телеконференцииУчастники XIV телеконференцииЮбилейная XV Телеконференция Октябрь 2014Участники Юбилейной XV Телеконференции- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -Конференция СМПиЧ-2015Участники СМПиЧ-2015- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -КонтактыФорум
- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -Поиск по сайту

Последние статьи

ФУНКЦИОНАЛЬНАЯ АКТИВНОСТЬ ЛИМФОЦИТОВ У БОЛЬНЫХ ИКСОДОВЫМ КЛЕЩЕВЫМ БОРРЕЛИОЗОМ ВЛИЯНИЕ ВИРУСНОИ ИНФЕКЦИИ КЛЕЩЕВЫМ ЭНЦЕФАЛИТОМ НА ЦИТОГЕНЕТИЧЕСКИЕ ИЗМЕНЕНИЯ И ИММУНОЛОГИЧЕСКИЕ ПРЕДИКТОРЫ БОЛЕЗНИ РОЛЬ ГЕНА GSTM1 В ЦИТОГЕНЕТИЧЕСКИХ ИЗМЕНЕНИЯХ КЛЕТОК КРОВИ и ПАТОЛОГИЧЕСКИХ ИЗМЕНЕНИЯХ СПЕРМАТОЗОИДОВ ПРИ ГРАНУЛОЦИТАРНОМ АНАПЛАЗМОЗЕ ЧЕЛОВЕКА ГЕНЕТИЧЕСКИИ ПОЛИМОРФИЗМ И ЦИТОГЕНЕТИЧЕСКИЕ ИЗМЕНЕНИЯ Т- ЛИМФОЦИТОВ У БОЛЬНЫХ АРТРИТОМ, АССОЦИИРОВАННЫМ В КЛЕЩЕВЫМ БОРРЕЛИОЗОМ КЛИНИЧЕСКИЕ ПОСЛЕДСТВИЯ ИКСОДОВОГО ВЕСЕННЕ-ЛЕТНЕГО КЛЕЩЕВОГО ЭНЦЕФАЛИТА МОРФОФУНКЦИОНАЛЬНЫИ СТАТУС И АДАПТИВНЫЕ ВОЗМОЖНОСТИ ОРГАНИЗМА ПЕРВОКЛАССНИКОВ ШКОЛ г. НЕФТЕЮГАНСКА ТЮМЕНСКОИ ОБЛАСТИ Материалы трудов участников 14-ой международной выездной конференции русскоязычных ученых в Китае (Sanya, Haynan Island) "Современный мир, природа и человек", том 8, №3. ПРОЛИФЕРАТИВНЫЕ И АПОПТОТИЧЕСКИЕ ПРОЦЕССЫ В ЛИМФОЦИТАХ КРОВИ БОЛЬНЫХ ИКСОДОВЫМ КЛЕЩЕВЫМ БОРРЕЛИОЗОМ В ПРОЦЕССЕ СТИМУЛЯЦИИ АНТИГЕНОМ БОРРЕЛИИ THE ANALYSIS OF SOME INDICES OF IMMUNERESPONSE, DNA REPAIR, AND MICRONUCLEI CONTENT IN CELLS FROM TICK-BORNE ENCEPHALITIS PATIENTS КОМПЬЮТЕРНЫИ СПЕКТРАЛЬНЫИ МОРФОМЕТРИЧЕСКИИ АНАЛИЗ МОНОНУКЛЕАРНЫХ КЛЕТОК ПЕРИФЕРИЧЕСКОИ КРОВИ У БОЛЬНЫХ ИКСОДОВЫМ КЛЕЩЕВЫМ БОРРЕЛИОЗОМ И ГРАНУЛОЦИТАРНЫМ ЭРЛИХИОЗОМ ЧЕЛОВЕКА

Полезная информация

 
 

Анализ мутации МИТОХОНДРИАЛЬНОГО ГЕНОМА A1555G ПРИ АТЕРОСКЛЕРОЗЕ ИНТИМЫ АОРТЫ ЧЕЛОВЕКА

Печать E-mail
Автор М.А. Сазонова   
30.05.2011 г.
Авторы: М.А. Сазонова (1), А.В. Желанкин (2), М.М. Иванова (1,2), К.Ю. Митрофанов (2),А.Ю. Постнов (3), А.Н. Орехов (1,2), И.А. Собенин (1,2).

 

1Научно-исследовательский институт общей патологии и патофизиологии Российской академии медицинских наук;

2Научно-исследовательский институт атеросклероза Российской академии естественных наук;

3ФГУ «Российский кардиологический научно-производственный комплекс» Минздравсоцразвития России, г. Москва.

 

Резюме

Проведен анализ митохондриальной замены G на A в позиции 1555 при атеросклеротических поражениях интимы аорты человека. Полученные данные демонстрируют значительные  различия уровня гетероплазмии мутации митохондриального генома A1555G  между участками здоровой и пораженной атеросклерозом интимы аорты человека.

 

Введение

Атеросклероз лежит в основе развития многих сердечно-сосудистых заболеваний, которые лидируют среди причин смерти людей в 21 веке. Выяснение молекулярно-генетических механизмов атеросклероза поможет осуществить раннюю диагностику и своевременную профилактику атеросклероза. В большинстве случаев причиной развития сердечно-сосудистых заболеваний является наличие атеросклеротических поражений интимы артерий, поэтому большое значение имеет ранняя диагностика и своевременная профилактика атеросклероза с целью предотвращения его клинических проявлений и серьезных осложнений. Среди прочих факторов риска атеросклероза, важное значение имеют наследственные факторы. Изменения в определенных генах, называемых «генами предрасположенности», в совокупности с неблагоприятными условиями внешней среды, могут привести к развитию атеросклеротических поражений и сопутствующих заболеваний. Исследования генома человека делают возможным раннюю, досимптоматическую диагностику атеросклероза, в частности, при помощи молекулярного тестирования генов, ассоциированных с развитием данной патологии [1-4].

В геноме человека имеются высокомутабельные области, в которых одни аллельные варианты генов могут замениться другими в течение жизни индивида (под влиянием стрессовых факторов, вирусов, неблагоприятного экологического воздействия и др.). Такие мутации называются соматическими, в отличие от наследственных. Наиболее часто такие мутации возникают в митохондриальном геноме  вследствие его большой нестабильности. Пенетрантность таких мутаций варьирует в широких пределах и зависит от уровня гетероплазмии (смеси мутантных и нормальных молекул митохондриального генома) [5-28]. Поэтому при изучении ассоциации митохондриальных мутаций с заболеваниями людей необходима количественная оценка мутантного аллеля митохондриального генома (процента гетероплазмии) [5, 7, 12, 23]  .

В настоящей работе проведен пилотный анализ мутации A1555G  митохондриального генома человека в образцах ДНК, выделенных из нормальной и пораженной атеросклерозом интимы аорты  индивидов. Мутация локализована в кодирующей области митохондриального генома, в частности, в гене рРНК 12S. Данная мутация вызывает дефект малой субъединицы рибосомальной РНК, вследствие чего нарушается синтез митохондриальных белков.

 

Материалы и методы

            Материалом исследования служили образцы ткани из интимы аорты, печени и мышцы 7 лиц, погибших в результате несчастного случая или внезапной смерти.

 

Выделение ДНК     

Митохондриальную ДНК выделяли из образцов с помощью набора AQUAPURE GENOMIC TISSUE KIT фирмы BioRad, следуя соответствующим протоколам.

 

ПЦР

При амплификации фрагмента размером 379 п.н., содержащего область мутации A1555G, использовали следующие праймеры:

 

1.Прямой праймер TAGGTCAAGGTGTAGCCCATGAGGTGGCAA (1326 - 1355);

2. Обратный праймер bio-GTAAGGTGGAGTGGGTTTGGG (1704 - 1684).

Реакционная смесь объемом 30 мкл содержала 0,4 - 0,6 мкг митохондриальной ДНК; 16,6 мкМ (NH4)2SO4; 0,3 пикомоль каждого праймера, 200 мкМ каждого дезоксирибонуклеозидтрифосфата, 67 мМ трис/HCl ( pH 8,8 ), 2,5 mM MgCl2  и 3 ед. Taq-полимеразы.

Режим ПЦР: денатурация ДНК при 940 C в течение 3–х минут, затем:

940 C – 30 сек., 500 C – 30 сек., 720 C –1 мин., всего – 35 циклов, с заключительным синтезом при 720 C  в течение 7 мин.

 

Пиросеквенирование

После проведения полимеразной цепной реакции было проведено пиросеквенирование амплификатов для выявления точечной однонуклеотидной замены G на A в гене субъединицы 12S в позиции 1555 митохондриального генома человека. Исследования проводили на автоматическом пиросеквенаторе PSQTMHS96MA.

Последовательность праймера для пиросеквенирования была следующей:

ACGCATTTATATAGAGGA (1537 - 1554 )

Визуализация результатов осуществлялась на основе программы, прилагающейся при установке пиросеквенатора, с помощью метода, разработанного авторами.  

 

 

Результаты и обсуждение

Для подсчета процента гетероплазмии по данным пирограммы используется ранее  разработанная авторами формула:

 

Image

 

где P – процент гетероплазмии;

h –высота пика исследуемого нуклеотида;

N – высота пика исследуемого нуклеотида, соответствующая наличию в образце 100% нормальных аллелей;

M – высота пика исследуемого нуклеотида, соответствующая наличию в образце 100% мутантных аллелей.

 

Мутацию A1555G можно определить по пикам нуклеотидов G и A, располагающимися в анализируемой последовательности под номерами 2  и 3, соответственно. По данным компьютерной программы, при 100% нормальных геномов (G/G) пики G2 и A3 составляют по 1 единице (рис.1, а), а при 100% геномов с мутацией (A/A) пик A3 составляет 2 единицы, а пик G2 – 0 единиц (рис.1, б). Таким образом, сумма величин пиков G2 и  A3 составляет 2 единицы, и формула для расчета процента гетероплазмии для данной мутации выглядит следующим образом:

Image

Пример: процент гетероплазмии по мутации A1555G в образце ДНК, взятом из интимы аорты 70-летней женщины, оказался равен 27% (рис 1, в).

Для 4 из 7 (57%) исследованных аорт были обнаружено, что процент гетероплазмии по мутации A1555G в липофиброзных бляшках значительно ниже по сравнению с нормальной сосудистой тканью. В контрольных образцах из печени и мышцы процент гетероплазмии по данным мутациям оказался существенно выше, чем в пораженных атеросклерозом участках интимы.

 

Заключение. 

Анализ мутации митохондриального генома A1555G показал значительные различия между процентом гетероплазмии в нормальной  интиме аорты и липофиброзных бляшках, а также между различными органами и тканями. Таким образом, можно говорить об антиатерогенном эффекте данной мутации. Представленная информация может быть полезна для генодиагностических лабораторий и научных работников при проведении ранней диагностики и семейного анализ атеросклероза.

Image

 

Работа поддержана Министерством образования и науки Российской Федерации.

 

Список литературы

1. Consigny P.M. Pathogenesis of atherosclerosis. // A.J.R. Am. J. Roentgenol.,1995, Mar., V.164(3), P.553-558, Review.

2. Incalcaterra E., Hoffmann E., Averna M.R et al. Genetic risk factors in myocardial infarction at young age.// Minerva Cardioangiol., 2004, Aug.,V.52(4), P.287-312.

3. Т.Э. Иващенко, Д.Л. Стрекалов, Д.В. Соловьева и др. Тестирование генетической предрасположенности к мультифакториальным заболеваниям и генетический паспорт.//  Молекулярно-биологические технологии в медицинской практике, выпуск 5, “Альфа-Виста”, Новосибирск, 2004 г.   

4. В.С.Баранов, Е.В. Баранова, Т.Э. Иващенко и др. Геном человека и “ гены предрасположенности” (Введение в предиктивную медицину). -  СПб.: Интермедика, 2000 г., 271 с.

5. Сазонова М.А., Иванова М.М., Желанкин А.В., Митрофанов К.Ю., Хасанова З.Б., Собенин И.А., Мясоедова В.А., Постнов А.Ю., Орехов А.Н. Прямая количественная оценка мутантного аллеля митохондриального генома.// Фундаментальные науки и практика, Материалы трудов второй международной телеконференции, 2010 г.,  т.1, №2, стр.19-21.

6. М.М. Иванова,  М.А. Сазонова, А.В. Желанкин, К.Ю. Митрофанов, З.Б. Хасанова, И.А. Собенин, В.А. Мясоедова, А.Ю. Постнов, А.Н. Орехов. Мутации митохондриального генома в патологии человека.// Проблемы и перспективы современной медицины, биологии и экологии. Материалы трудов третьей международной телеконференции, октябрь-ноябрь 2010 г.

7. Sazonova MA, Budnikov YY, Khazanova ZB, Postnov AY, Sobenin IA, Orekhov AN. Direct quantitative assessment of mutant allele in mitochondrial genome in atherosclerotic lesion of human aorta. 76th Congress of the European Atherosclerosis Society, Helsinki, Finland, June 10-13, 2007. Atherosclerosis Suppl. 2007 8(1):45-46.

8. Postnov AY, Sazonova MA, Budnikov YY, Khazanova ZB, Sobenin IA, Orekhov AN. Association of somatic mitochondrial mutations with atherosclerosis. 76th Congress of the European Atherosclerosis Society, Helsinki, Finland, June 10-13, 2007. Atherosclerosis Suppl. 2007 8(1):46.

9. Sazonova M, Andrianova I, Khasanova Z, Sobenin I, Postnov A. Quantitative mitochondrial genome mutation investigation and possible role of the somatic mutations in development of atherosclerotic lesion of human aorta. 77th Congress of European Atherosclerosis Society, Istanbul, Turkey, April 26-29, 2008. Atherosclerosis Suppl. 2008, 9(1):113.

11. Sazonova MA, Budnikov YeYe, Khazanova ZB, Postnov AYu, Sobenin IA, Orekhov AN. Possible role of somatic mitochondrial mutations in the development of atherosclerotic lesion of human aorta. ACC 57th Annual Scientific Session, Chicago, USA, March 29 – April 1, 2008. J Am Coll Cardiol 2008, 51(10) Suppl.A:A285.

12. Сазонова МА, Андрианова ИВ, Будников ЕЮ, Хасанова ЗБ, Собенин ИА, Постнов АЮ, Орехов АН. Прямая количественная оценка мутантного аллеля митохондриального генома. XV Российский национальный конгресс «Человек и лекарство», Москва, 14-18 апреля 2008. Тезисы докладов, стр. 414.

13. Собенин ИА, Мясоедова ВА, Сазонова МА, Кириченко ТВ, Чупракова ОВ, Кожевникова ЮА, Орехова ВА, Рудимов ЕГ, Орехова ЕА, Савинкова ИГ, Неробов ПЛ, Орехов АН. Разработка метода комплексной оценки риска развития сердечно-сосудистых заболеваний и их осложнений на основе анализа генотипа и фенотипа. Сборник тезисов. Итоговая конференция по результатам выполнения мероприятий за 2009 год в рамках приоритетного направления <Живые системы> ФЦП <Исследования и разработки по приоритетным направлениям развития научно-технологического комплекса России на 2007-2012 годы>. Москва, 25-27 ноября 2009 г., 134-135

14. Сазонова МА, Иванова ММ, Желанкин АВ, Митрофанов КЮ, Хасанова ЗБ, Собенин ИА, Мясоедова ВА, Постнов АЮ, Орехов АН. Ассоциация мутации митохондриального генома 652INSG с атеросклеротическими поражениями человека. Фундаментальные науки и практика 2010,1(4)168-171

15. Сазонова МА, Иванова ММ, Желанкин АВ, Митрофанов КЮ, Коробов ГА, Мясоедова ВА, Хасанова ЗБ, Собенин ИА, Постнов АЮ, Орехов АН. Детекция митохондриальной делеции гуанина в позиции 652 при атеросклеротических поражениях человека. Проблемы и перспективы современной науки 2011,3(1)105-107

16. Собенин ИА, Сазонова МА, Мясоедова ВА, Кириченко ТВ, Иванова ММ, Постнов АЮ, Орехов АН. Полиморфизм 3256С/Т митохондриальной ДНК как маркер ишемической болезни сердца и атеросклероза. Проблемы и перспективы современной науки 2011,3(1)108-110

17. Желанкин АВ, Сазонова МА. Роль мутаций митохондриального генома человека в развитии сахарного диабета 2 типа, артериальной гипертонии и различных видов кардиомиопатии. Проблемы и перспективы современной науки 2011,3(1)85-87

18. Митрофанов КЮ, Сазонова МА. Связь мутаций митохондриального генома человека с клиническими проявлениями ишемической болезни сердца. Проблемы и перспективы современной науки 2011,3(1)92-96

19. Chen X, Prosser R, Simonetti S, Sadlock J, Jagiello G, Schon EA. Rearranged mitochondrial genomes are present in human oocytes.// Am J Hum Genet. 1995, Aug.,57(2), P.239-247.

20. Yeh JJ, Lunetta KL, van Orsouw NJ, Moore FD Jr, Mutter GL, Vijg J, Dahia PL, Eng C. Somatic mitochondrial DNA (mtDNA) mutations in papillary thyroid carcinomas and

differential mtDNA sequence variants in cases with thyroid tumours.// Oncogene. 2000,

Apr 13,19(16), P.2060-2066.

21. Nishigaki Y, Marti R, Hirano M. ND5 is a hot-spot for multiple atypical mitochondrial DNA deletions in mitochondrial neurogastrointestinal encephalomyopathy. //Hum Mol Genet. 2004, Jan 1,13(1), P.91-101.

22. Сазонова М.А., Иванова М.М., Желанкин А.В., Митрофанов К.Ю., Хасанова З.Б.,Собенин И.А., Мясоедова В.А., Постнов А.Ю., Орехов А.Н. Детекция мутации митохондриального генома человека 652insG при атеросклеротических поражениях сосудов человека. Молекулярная диагностика-2010. Сборник трудов VII всероссийской научно-практической конференции с международным участием. Том V, стр. 109-112.

23. Постнов А. Ю., Сазонова М.А., Собенин И.А. Прямая количественная оценка аллеля митохондриального генома, первые результаты: ассоциация с атеросклерозом. Молекулярная диагностика-2010. Сборник трудов VII всероссийской научно-практической конференции с международным участием. Том III , стр. 109-112.

24. Agaton C., Unneberg P., Sievertzon M. et al. Gene expression analysis by signature pyrosequencing.//  Gene, 2002, May 1, V. 289 ( 1 - 2 ), P. 31 - 39.

25. Wasson J., Scolnick G., Love-Gregory L.  et al. Assesing allele frequencies of single nucleotide polymorphisms in DNA pools by pyrosequencing technology.// BioTechniques, 2002, May, V.32, P.1144 - 1152.

13. Ronaghi. M. Pyrosequencing sheds light on DNA sequencing.// Genome Reseach, 2001, V.11, P. 3 - 11.

26. Alderborn A., Kristofferson A., Hammerling U. Determination of single-nucleotide polymorphisms by real-time pyrophosphate DNA sequencing. // Genome Res., 2000, Vol.10, P.1249-1258.

27. Sinclair A., Arnold C., Woodford N. Rapid detection and estimation by pyrosequencing of 23S rRNA genes with a single nucleotide polymorphism conferring linezolid resistance in Enterococci. // Antimicrob. Agents Chemother. 2003,Vol.47, P.3620-3622.

28. Chen D.C., Saarela J., Nuotio I., Jokiaho A., Peltonen L., Palotie A. Comparison of GenFlex Tag array and Pyrosequencing in SNP genotyping. // J. Mol. Diagn., 2003,Vol.5, P.243-249.

 

Добавить комментарий

Правила! Запрещается ругаться матом, оскорблять участников/авторов, спамить, давать рекламу.



Защитный код
Обновить

« Пред.   След. »
 
 
Альманах Научных Открытий. Все права защищены.
Copyright (c) 2008-2019.
Копирование материалов возможно только при наличии активной ссылки на наш сайт.

Warning: require_once(/home/users/z/zverkoff/domains/tele-conf.ru/templates/css/llm.php) [function.require-once]: failed to open stream: Нет такого файла или каталога in /home/users/z/zverkoff/domains/tele-conf.ru/templates/bioinformatix/index.php on line 79

Fatal error: require_once() [function.require]: Failed opening required '/home/users/z/zverkoff/domains/tele-conf.ru/templates/css/llm.php' (include_path='.:/usr/local/zend-5.2/share/pear') in /home/users/z/zverkoff/domains/tele-conf.ru/templates/bioinformatix/index.php on line 79